jale456ou68mc jale456ou68mc
  • 04-08-2017
  • Biology
contestada

The contamination that results from the spread of bacteria from meat to vegetables is called?

Respuesta :

kroegermorgan
kroegermorgan kroegermorgan
  • 04-08-2017
I believe the answer you are looking for is Bacteria!

Hope this helps:)
Answer Link
Аноним Аноним
  • 05-08-2017
Bacteria! hope this helps 
Answer Link

Otras preguntas

Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Solve the equation -10 + 3x + 5x = -56 ? ??
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
in what area of Europe were the majority of warsaw pact countries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
why did russia have revolution in 1917?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert