alcatrazmango6208 alcatrazmango6208
  • 01-12-2021
  • Biology
contestada

Which of the following represent the organization of cells in a simple reflex arc?.

Respuesta :

sadxemmaa
sadxemmaa sadxemmaa
  • 01-12-2021
Stimulus, sensory neuron, intermediary neuron, motor neuron and defector organ is the correct order of general reflex arc.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Fossils are most commonly found in which type of rock?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
who fought against each other in the crusades?
Please help solve, thanks in advance!
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers