shahhaian shahhaian
  • 01-11-2021
  • Mathematics
contestada

What is the decimal between 1.5 and two

Respuesta :

laylagray891 laylagray891
  • 01-11-2021

Answer:

0.75

Step-by-step explanation:

1.5 divided by 2 = 0.75

Answer Link

Otras preguntas

Whis is equal to 0.0865 hectometers? 86.5 millimeters 865 millimeters 8,650 millimeters 86,500milimeters
Which of the following best states Mallon’s purpose in writing this letter?
Order the numbers from greatest to least based on their absolute value. |− 2 5 |, |0.5|, |− 3 4 |, |0.35| A) |0.5| > |0.35| > |− 2 5 | > |− 3 4 | B) |−
plss help Lawrence Sullivan "Sul" Ross (pictured here) served in all of the following roles EXCEPT A) the 19th governor of Texas. B) President of Texas A&
According to the fifth amendment people who are accused of the crime cannot
What is the value of the expression-7 3/4 + 3 1/2
"A small company wishes to set up a fund" that can be used for technology purchases over the next 6 years. Their forecast is for $12,000 to be needed at the end
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
5. What two factors can increase the force of air resistance for an object?
A squad needs to cross a narrow footbridge across a windy, mountain chasm to execute a critical mission. The squad leader is concerned about the hazards and ass