tiarikisten tiarikisten
  • 02-03-2021
  • Physics
contestada

a wall is painted yellow with yellow paint. explain why the paint makes the wall look yellow

Respuesta :

hannahjk0396 hannahjk0396
  • 02-03-2021
The paint makes the wall look yellow because of the pigment in it.
Answer Link
hiitszara
hiitszara hiitszara
  • 02-03-2021
Because the paint has pigment in it


If there was no pigment in the paint the wall would be a dull white colour
Answer Link

Otras preguntas

4.2meters= how many centimeter
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
who was the founder of Pennsylvania?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
how would u form a superlative for the adverb widely
what was paul revere failures