brndjsjkdid brndjsjkdid

01-11-2020
Mathematics

contestada

Which equation represents a line which is perpendicular to the line 2x + 7y=14?

Respuesta :

Renae360 Renae360

01-11-2020

Answer:

The answer to the question provided is y = 7/2x + 2

(I think)

Answer Link

Аноним Аноним

10-06-2021

Answer:

y=− 7 2 x−5

Step-by-step explanation:

Answer Link

Otras preguntas

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?

In a class of 7, there are 3 students who have done their homework. If the teacher chooses 3 students, what is the probability that none of the three students h

What is the solution 4x+1y ≤48 and 10 ≤y ?

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

what was considered an act of war in 1914?

The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."

If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Today many educators would like math instruction to be more active and engaging instead of based on rote memory of principles and definitions. a. True b. Fals

define intrinsic motivation